|
Run Name
|
Name of the run.
|
|
Run Date
|
Date and time the Ion PGM™ or Ion Proton™ run was started.
|
|
Run Cycles
|
Number of Ion PGM™ or Ion Proton™ cycles analyzed for this report. Note that this number can differ from the total number of cycles run on the sequencer.
|
|
Run Flows
|
Number of Ion PGM™ or Ion Proton™ nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the sequencer.
|
|
Project
|
Names of the projects the result set is a member of.
|
|
Sample
|
Name of the sample assigned to the run used to generate this analysis. This is assigned on theIon PGM™ or Ion Proton™ Sequencer.
|
|
Sample Tube Label
|
The label or written text on a sample tube used to track each sample through the sequencing workflow.
|
|
Reference
|
Name of the library assigned to the run used to generate this analysis. This library name is used to specify the reference genome used for alignment.
|
|
Instrument
|
Name of the sequencing instrument on which the run was performed.
|
|
Flow Order
|
Flow order selected on Ion PGM™ or Ion Proton™ Ion Proton™ Sequencer: Samba = TACGTACGTCTGAGCATCGATCGATGTACAGC [Default]Regular = TACG The "regular" flow order adds bases most rapidly to sequenced molecules but is vulnerable to phase errors. The Samba flow order consists of a 32-base sequence, repeated. This flow order resists phase errors by providing opportunities for out-of-phase molecules to catch up and is designed to sample all dimer (nucleotide pair) sequences, efficiently. Samba is the default flow order because it improve sequencing accuracy for longer reads by resisting phase errors.
|
|
Library Key
|
A short known sequence of bases used to distinguish the library fragment from the test fragment. Example: "TCAG"
|
|
TF Key
|
A short known sequence of bases used to distinguish the test fragment.
|
|
Chip ID
|
The ID number of the chip that appears on the chip barcode label.
|
|
Chip Check
|
A series of tests on reference wells (about 10% of the chip in non-addressable areas) is performed to ensure that the chip is functioning at a basic level. The value of this field is either Passed or Failed.
|
|
Chip Type
|
Type of chip used on the Ion PGM™ Sequencer. Usually, 314, 316, or 318 (for the Ion 314™ chip, Ion 316™ chip, and Ion 318™ chip.) A letter follows the numbers, indicating the chip version.
|
|
Chip Data
|
In this release, the value is single, for a forward run.
|
|
Chip Lot Number
|
The lot number of the chip as scanned by the Ion Proton™ Sequencer or Ion S5™ Sequencer. Not available for Ion PGM™ runs.
|
|
Barcode Set
|
The name of the barcode set assigned to the run. Blank for non-barcode libraries.
|
|
Analysis Name
|
Name of the analysis provided in Torrent Suite™ Software when the analysis was started. If the analysis was scheduled to auto-start, this is the default analysis name.
|
|
Analysis Date
|
Date the analysis was performed.
|
|
Analysis Flows
|
Number of Ion PGM™ orIon Proton™ nucleotide flows analyzed for this report. Note that this number can differ from the total number of flows occurring on the Ion PGM™ orIon Proton™ Sequencer.
|
|
runID
|
The run code that the Torrent Suite™ Software assigned to the planned run for this analysis.
|
